View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6178_high_61 (Length: 287)
Name: NF6178_high_61
Description: NF6178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6178_high_61 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 36 - 270
Target Start/End: Original strand, 48375014 - 48375248
Alignment:
| Q |
36 |
ctagaatattcattcacaaaccttacaatgccgtacggtgaatcctccaccgctgcttccgttcagtttccgccggagacctccgatcatggaaaaactc |
135 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48375014 |
ctagaatattcattcacaaaccttacaatgccgtacggtgaatcctccaccgctgcttccgttcagtttccgccggagacctccgatcatggaaaaactc |
48375113 |
T |
 |
| Q |
136 |
cttcccttgacgttgagtcttctctagtcaaaaaagatcccacaaaaattgctagaaagtaagtcactttttcatgccctttgtgtttttcttcactcta |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
48375114 |
cttcccttgacgttgagtcttctctagtcaaaaaagatcccaccaaaattgctagaaagtaagtcactttttcataccctttgtgtttttcttcactcta |
48375213 |
T |
 |
| Q |
236 |
ctacgnnnnnnnncaattgggcatgtgggttttct |
270 |
Q |
| |
|
||||| ||| |||||||||||||||||| |
|
|
| T |
48375214 |
ctacgttttttttcaactgggcatgtgggttttct |
48375248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University