View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6178_high_63 (Length: 268)
Name: NF6178_high_63
Description: NF6178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6178_high_63 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 9 - 252
Target Start/End: Complemental strand, 2529041 - 2528798
Alignment:
| Q |
9 |
cacagaaacagacacagcagaaagtagaaacaggaatgtgcagacaatagttgttgtgatcattgtaatagtaacattgtttgtcatttctggcatgatt |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2529041 |
cacagaaacagacacagcagaaagtagaaacaggaatgtgcagacaatagttgttgtgatcattgtaatagtaacattgtttgtcatttctggcatgatt |
2528942 |
T |
|
| Q |
109 |
tatgtgggactaaaatgctcaaagaaaaaggaaaatttgcctgaatctctggttcagaattcagacggtgatgacgatttcttgaagagtttaactagta |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2528941 |
tatgtgggactaaaatgctcaaagaaaaaggaaaatttgcctgaatctctggtcgagaattcagacggtgatgacgatttcttgaagagtttaactagta |
2528842 |
T |
|
| Q |
209 |
tgccgatccgtttcagctacaacaatttagaaactgcgacgaat |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2528841 |
tgccgatccgtttcagctacaacaatttagaaactgcgacgaat |
2528798 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University