View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6178_high_66 (Length: 263)
Name: NF6178_high_66
Description: NF6178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6178_high_66 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 245
Target Start/End: Complemental strand, 13160183 - 13159939
Alignment:
| Q |
1 |
caaataatatagcggtttcgaatgcgatatgaaactcaatattgtgggcactgccccctgattttgagtccttattacgtgacttgttatatatacatac |
100 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13160183 |
caaataagatagcggtttcgaatgcgatatgaaactcaatattgtgggcactgccccctgattttgagtccttattacgtgacttgttatatatacatac |
13160084 |
T |
 |
| Q |
101 |
attttttcttcccttatatcaccatcatcttcttttagccatcgtcctcaaaattcaataaaatttcatttgtctaactttatcattgagatcttgtaat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
13160083 |
attttttcttcccttatatcaccatcatcttcttttagccatcgtcctcaaccttcaataaaatttcatttgtctaactttatcattgagatctagtaat |
13159984 |
T |
 |
| Q |
201 |
aatataagctatgtttatcagacnnnnnnntctccataattgagt |
245 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
13159983 |
aatataagctatgtttatcagacataaaaatctccataattgagt |
13159939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University