View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6178_high_71 (Length: 250)
Name: NF6178_high_71
Description: NF6178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6178_high_71 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 109; Significance: 6e-55; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 11 - 123
Target Start/End: Original strand, 25645278 - 25645390
Alignment:
| Q |
11 |
caaaggataccaattgaacttcaagttgaagacattgtatgttgccacaattttccaacacattcttagactctttatgtccacaaacacaagcatgcat |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25645278 |
caaaggataccaattgaacttcaagttgaagacattgtatgttgtcacaattttccaacacattcttagactctttatgtccacaaacacaagcatgcat |
25645377 |
T |
|
| Q |
111 |
gtgcgatgatttt |
123 |
Q |
| |
|
||||||||||||| |
|
|
| T |
25645378 |
gtgcgatgatttt |
25645390 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 15 - 132
Target Start/End: Complemental strand, 25941455 - 25941337
Alignment:
| Q |
15 |
ggataccaattgaacttcaagttgaagacattgtatgttgccacaattttccaacacattcttagactctttatgt-ccacaaacacaagcatgcatgtg |
113 |
Q |
| |
|
||||||||||| ||||||||| ||||| |||||||||||||||||||||||||||||| |||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
25941455 |
ggataccaattcaacttcaaggtgaaggcattgtatgttgccacaattttccaacacaatcttaggctctttatgtcccacaaacacaagcatgcatgtg |
25941356 |
T |
|
| Q |
114 |
cgatgattttattgctttt |
132 |
Q |
| |
|
| ||||||||||||||||| |
|
|
| T |
25941355 |
caatgattttattgctttt |
25941337 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University