View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6178_low_49 (Length: 329)
Name: NF6178_low_49
Description: NF6178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6178_low_49 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 201; Significance: 1e-109; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 201; E-Value: 1e-109
Query Start/End: Original strand, 100 - 312
Target Start/End: Original strand, 39949044 - 39949256
Alignment:
| Q |
100 |
ttacacatgctacaatacaagagacaagcatgtttcaataatccacctgggtttgagattgcgagtcaaaggggctttaatcactttattgtaaaaagtg |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
39949044 |
ttacacatgctacaatacaagagacaagcatgtttcaataatccacctgggtttgagattacgagtcaaaggggcttttatcactttattgtaaaaagtg |
39949143 |
T |
 |
| Q |
200 |
actctactgctattgtttgaatcttacataaaattgttcagtgaatcatccttacttctcctcggatgatttcagcatttgaagataaaatttgacattt |
299 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39949144 |
actctattgctattgtttgaatcttacataaaattgttcagtgaatcatccttacttctcctcggatgatttcagcatttgaagataaaatttgacattt |
39949243 |
T |
 |
| Q |
300 |
ggttttcaatctt |
312 |
Q |
| |
|
||||||||||||| |
|
|
| T |
39949244 |
ggttttcaatctt |
39949256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University