View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6178_low_52 (Length: 324)
Name: NF6178_low_52
Description: NF6178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6178_low_52 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 275; Significance: 1e-154; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 275; E-Value: 1e-154
Query Start/End: Original strand, 4 - 309
Target Start/End: Complemental strand, 26955000 - 26954690
Alignment:
| Q |
4 |
tcagaagagagttgatccaggatgcaataatggctaatgctttgtacttagccttggtggatgaccttgctactgctctt-----cgatgatttccacaa |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
26955000 |
tcagaagagagttgatccaggatgcaataatggctaatgctttgtacttagccttggtggatgaccttgctactgctctttgcttcgatgatttccacaa |
26954901 |
T |
|
| Q |
99 |
gatgaggttggaactctagtagacaatgtgagcagatgtgtagtcatctttattatcagtccaatcagtatccttatatgcaatgagtgtagaagaattc |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26954900 |
gatgaggttggaactctagtagacaatgtgagcagatgtgtagtcatctttattatcagtccaatcagtatccttatatgcaatgagtgtagaagaattc |
26954801 |
T |
|
| Q |
199 |
tgtttccgaagaaaaaggccatgaaaattgtacctttgaggcggcgcagaatcctctttagaggagtcaaatgagtggtagtgaatctttgcacgaacta |
298 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| |||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
26954800 |
tgtttccgaagaaaaaggccatgaaaattgtacctctgatgcggtgcagaatcctctttagaggagtcaaatgagtggtagtggatctttgcacgaacta |
26954701 |
T |
|
| Q |
299 |
agaaagattat |
309 |
Q |
| |
|
||||||||||| |
|
|
| T |
26954700 |
agaaagattat |
26954690 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University