View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6178_low_75 (Length: 249)
Name: NF6178_low_75
Description: NF6178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6178_low_75 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 66; Significance: 3e-29; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 86 - 171
Target Start/End: Original strand, 27059816 - 27059901
Alignment:
| Q |
86 |
ttgtggatattatggaggtgttagatctttgttaaacaaaatggggcgtcataaacctcttcggtgttttgggttggaattaggaa |
171 |
Q |
| |
|
||||||||||| ||||||| ||||| || ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
27059816 |
ttgtggatattctggaggtattagaactgtgttaaacaaaatggggcgtcataaacgtcttcggtgttttgggttggaattaggaa |
27059901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 164 - 230
Target Start/End: Original strand, 27065002 - 27065068
Alignment:
| Q |
164 |
attaggaactcatatgtaacacacttgcataagagaaagtcatagtgtctctttggaagtttgacga |
230 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||| || | |||||||||||||||| |
|
|
| T |
27065002 |
attaggaacttatatgtaacacacttgcataagagaaagtcatagcgtgtgtttggaagtttgacga |
27065068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 17 - 69
Target Start/End: Original strand, 32329665 - 32329717
Alignment:
| Q |
17 |
tttattatgacaagtgggagggtgtaggagaggggtataccacgtaagggtgt |
69 |
Q |
| |
|
|||||| ||||||||||||||||||| |||||||||| |||| |||||||||| |
|
|
| T |
32329665 |
tttattgtgacaagtgggagggtgtatgagaggggtacaccatgtaagggtgt |
32329717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 56; Significance: 3e-23; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 11 - 86
Target Start/End: Original strand, 44682421 - 44682496
Alignment:
| Q |
11 |
ttatactttattatgacaagtgggagggtgtaggagaggggtataccacgtaagggtgtttacctatcaactctct |
86 |
Q |
| |
|
||||| |||||| ||||||||||||||||||| |||||||||| ||||||||||||||||||||||||| |||||| |
|
|
| T |
44682421 |
ttatattttattgtgacaagtgggagggtgtaagagaggggtacaccacgtaagggtgtttacctatcagctctct |
44682496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University