View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6178_low_78 (Length: 245)
Name: NF6178_low_78
Description: NF6178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6178_low_78 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 194; Significance: 1e-105; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 18 - 236
Target Start/End: Complemental strand, 11009968 - 11009750
Alignment:
| Q |
18 |
gagcctaacttctgtaaagtcactatcaaatgctagctagcttccactatactgcgataattaagcgtcatgtaaaatgtgacatatacttttttattta |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11009968 |
gagcctaacttctgtaaagtcactatcaaatgctagctagcttccactatactgcgataattaagcgtcatgtaaaatgtgacatatacttttttattta |
11009869 |
T |
 |
| Q |
118 |
tatggatggatgcttaattcgcacgtatttaatgtgctagnnnnnnncacttgctataatcggaaaaccaaaaatgccatccttaacccttgttgtggtg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11009868 |
tatggatggatgcttaattcgcacgtatttaatgtgctagtttttttcacttgctataatcggaaaaccaaaaatgccatccttaacccttgttgtggtg |
11009769 |
T |
 |
| Q |
218 |
tcactaatactgatattct |
236 |
Q |
| |
|
| ||||||||||||||||| |
|
|
| T |
11009768 |
ttactaatactgatattct |
11009750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 176 - 236
Target Start/End: Complemental strand, 11019843 - 11019783
Alignment:
| Q |
176 |
atcggaaaaccaaaaatgccatccttaacccttgttgtggtgtcactaatactgatattct |
236 |
Q |
| |
|
|||||||||| |||||||| |||||||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
11019843 |
atcggaaaacaaaaaatgcaatccttaacctttgttgtggtgttactaatactgatattct |
11019783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 177 - 236
Target Start/End: Complemental strand, 11035213 - 11035154
Alignment:
| Q |
177 |
tcggaaaaccaaaaatgccatccttaacccttgttgtggtgtcactaatactgatattct |
236 |
Q |
| |
|
||||||||| ||||||| | ||||||||| |||||||| ||| ||||||||||||||||| |
|
|
| T |
11035213 |
tcggaaaacaaaaaatgtcttccttaacctttgttgtgctgttactaatactgatattct |
11035154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University