View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6178_low_83 (Length: 235)

Name: NF6178_low_83
Description: NF6178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6178_low_83
NF6178_low_83
[»] chr5 (1 HSPs)
chr5 (17-217)||(19299949-19300147)


Alignment Details
Target: chr5 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 17 - 217
Target Start/End: Original strand, 19299949 - 19300147
Alignment:
17 atatgcacttatgcaccataggaatataaatttcaagagtatggtttttacttggaaaagggaaatagaacttaattgaaaaactagtaaattgtcatca 116  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
19299949 atatgcacttatgcaccataggaatataaatttcaagagtatggtttt-acttggaaaagggaaatagaacttaattgaaaaactagtaaattgtcatca 19300047  T
117 tgcttcaaagaagaacatgaaaagaaacaaattactcctaccaaataatgaatctaagaaaccatnnnnnnngtaccaaccaattacccacttgtctgta 216  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       ||||||||||||||||||||||||||||    
19300048 tgcttcaaagaagaacatgaaaagaaacaaattactcctaccaaataatgaatctaagaaaccat-aaaaaagtaccaaccaattacccacttgtctgta 19300146  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University