View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6178_low_86 (Length: 228)
Name: NF6178_low_86
Description: NF6178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6178_low_86 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 9 - 219
Target Start/End: Complemental strand, 7618683 - 7618473
Alignment:
| Q |
9 |
atcaatacctttaatgctctccagtatgcagttccaggaaaattcaatggtgctgatacaacacctttcataaaagtaacatactctttctttaagttct |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7618683 |
atcaatacctttaatgctctccagtatgcagttccaggaaaattcaatggtgctgatacaacacctttcataaaagtaacatactctttctttaagttct |
7618584 |
T |
 |
| Q |
109 |
ctgtctctattttcccaggttgaagactcataatgtgttctgccatcaaattaaatgtgaactgcaatataaaccaaacaaactttagtttatctttatc |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
7618583 |
ctgtctctattttcccaggttgaagactcataatgtgttctgccatcaaattaaatgtgaactgcaatttaaaccaaacaaactttagtttatctttatc |
7618484 |
T |
 |
| Q |
209 |
tattaaatata |
219 |
Q |
| |
|
||||||||||| |
|
|
| T |
7618483 |
tattaaatata |
7618473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 14 - 97
Target Start/End: Original strand, 33107149 - 33107232
Alignment:
| Q |
14 |
tacctttaatgctctccagtatgcagttccaggaaaattcaatggtgctgatacaacacctttcataaaagtaacatactcttt |
97 |
Q |
| |
|
||||||||||||| | | |||||||||||| || |||||||| || || || |||||||||||||| ||| ||||||||||| |
|
|
| T |
33107149 |
tacctttaatgcttttctgtatgcagttcctggcaaattcaaaggagcagaaacaacacctttcatgaaacagacatactcttt |
33107232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University