View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6178_low_87 (Length: 227)
Name: NF6178_low_87
Description: NF6178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6178_low_87 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 6638157 - 6637936
Alignment:
| Q |
1 |
cattttcatctcaactttgagtcacttaagtttttctctcaaactaacaaccatccaccatactagcccttcctattcccaattattagcaacaatctca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6638157 |
cattttcatctcaactttgagtcacttaagtttttctctcaaactaacaaccatccaccatactagcccttcctattcccaattattagcaacaatctca |
6638058 |
T |
|
| Q |
101 |
aagaagcccatatgttttaacc-aaaattgatgagcctaaaagctctgagaccacaaggctgactatctaacaccaaaggaaaattatcaaataaatttg |
199 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6638057 |
aagaagcccatatgttttaaccaaaaattgatgagcctaaaaggtctgagaccacaaggctgactatctaacaccaaaggaaaattatcaaataaatttg |
6637958 |
T |
|
| Q |
200 |
tattcaaagcccacggactttc |
221 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
6637957 |
tattcaaagcccacggactttc |
6637936 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University