View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6178_low_90 (Length: 218)
Name: NF6178_low_90
Description: NF6178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6178_low_90 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 109; Significance: 5e-55; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 96 - 208
Target Start/End: Complemental strand, 37122209 - 37122097
Alignment:
| Q |
96 |
ccagattgggccatcgcggattgtatcttgaattccaaggttctaatatgttataagatgtaatagttagttacaataatcagttacattatataataat |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37122209 |
ccagattgggccatcgcggattgtatcttgaattccaaggttctaatatgttataagatgtaatagttagttacaataatcagttacattatataataat |
37122110 |
T |
 |
| Q |
196 |
ttttgtatctctg |
208 |
Q |
| |
|
| ||||||||||| |
|
|
| T |
37122109 |
tgttgtatctctg |
37122097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 10 - 65
Target Start/End: Complemental strand, 37122264 - 37122209
Alignment:
| Q |
10 |
aattcacgtgaaatccaatcacttcaattcaatccttcatttctatttaccgtttc |
65 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
37122264 |
aattcacgtgaaatccaatcacttcaattcaatccttcatttctgtttaccgtttc |
37122209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 151 - 183
Target Start/End: Original strand, 29051293 - 29051325
Alignment:
| Q |
151 |
agatgtaatagttagttacaataatcagttaca |
183 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |
|
|
| T |
29051293 |
agatgtaatagttagttacaataattagttaca |
29051325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 155 - 183
Target Start/End: Complemental strand, 486634 - 486606
Alignment:
| Q |
155 |
gtaatagttagttacaataatcagttaca |
183 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
486634 |
gtaatagttagttacaataatcagttaca |
486606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University