View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6178_low_92 (Length: 212)
Name: NF6178_low_92
Description: NF6178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6178_low_92 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 167; Significance: 1e-89; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 14 - 192
Target Start/End: Original strand, 4498620 - 4498798
Alignment:
| Q |
14 |
gatgaacaattgtaccaaacttaaacaagttttggagggtggaaattccgatgcaggtttcttcaacacattagatttctacataggaatgggagttgga |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
4498620 |
gatgaacaattgtaccaaacttaaacaagttttggagggtggaaattccgatgcaggtttcttcaacacatcagatttctacataggaatgggagttgga |
4498719 |
T |
|
| Q |
114 |
tttgcagcagggttttggggggtttgcattgctattttctttatcagaacttgcaggcatgcttattttcattttcttg |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4498720 |
tttgcagcagggttttggggggtttgcattgctactttcttgatcagaacttgcaggcatgcttattttcattttcttg |
4498798 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 127; E-Value: 9e-66
Query Start/End: Original strand, 14 - 192
Target Start/End: Complemental strand, 4329289 - 4329111
Alignment:
| Q |
14 |
gatgaacaattgtaccaaacttaaacaagttttggagggtggaaattccgatgcaggtttcttcaacacattagatttctacataggaatgggagttgga |
113 |
Q |
| |
|
|||||| |||||||| ||| | ||||||||||||||| |||||||||| ||||| |||||| | |||||| |||||||||| ||||||||||||||||| |
|
|
| T |
4329289 |
gatgaataattgtacaaaaatgaaacaagttttggagcgtggaaattctgatgctggtttcgttgacacatcagatttctacgtaggaatgggagttgga |
4329190 |
T |
|
| Q |
114 |
tttgcagcagggttttggggggtttgcattgctattttctttatcagaacttgcaggcatgcttattttcattttcttg |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
4329189 |
tttgcagcagggttttggggggtttgcattgctattttctttaacagaacttgcaggcatgcttattttcattttcttg |
4329111 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University