View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6181_low_3 (Length: 237)
Name: NF6181_low_3
Description: NF6181
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6181_low_3 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 51; Significance: 2e-20; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 113 - 167
Target Start/End: Original strand, 35937441 - 35937495
Alignment:
| Q |
113 |
aagtctatatacatatcggatatcttccaaacattttggttagaacatattctta |
167 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
35937441 |
aagtctatatacatatcggatatctaccaaacattttggttagaacatattctta |
35937495 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 5 - 52
Target Start/End: Original strand, 35937333 - 35937380
Alignment:
| Q |
5 |
gaacaacaataatactttgttttaatttttgcatcacctattcaaagc |
52 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| |||||||||| |
|
|
| T |
35937333 |
gaacaacaataatacttagttttaatttttgcagcacttattcaaagc |
35937380 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University