View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6182_high_22 (Length: 247)
Name: NF6182_high_22
Description: NF6182
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6182_high_22 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 156; Significance: 5e-83; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 61 - 237
Target Start/End: Complemental strand, 28398184 - 28398012
Alignment:
| Q |
61 |
acattggtataacatttttcctattataatttttcagttttgtatcaatgaaattaattagaaatagtgacaacctcatgctatgacaaatttagatttc |
160 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28398184 |
acattggtataacatttttcctattattatttttcagttttgtatcaatgaaatta----gaaatagtgacaacctcatgctatgacaaatttagatttc |
28398089 |
T |
|
| Q |
161 |
tcaagttgtggacactttatgaagactgctagaatgtcgtaacaaatagttggaactcttgaattagtggttgtcct |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28398088 |
tcaagttgtggacactttatgaagactgctagaatgtcgtaacaaatagttggaactcttgaattagtggttgtcct |
28398012 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 4 - 59
Target Start/End: Complemental strand, 28398304 - 28398248
Alignment:
| Q |
4 |
atcactcacaaatatttgtctcgtatttttt-atttatatttatcactcacaaatat |
59 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
28398304 |
atcactcacaaatatttgtctcgtatttttttatttatatttatcactcacaaatat |
28398248 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 4 - 57
Target Start/End: Complemental strand, 28390451 - 28390398
Alignment:
| Q |
4 |
atcactcacaaatatttgtctcgtattttttatttatatttatcactcacaaat |
57 |
Q |
| |
|
|||||||||||||||| ||| ||||| ||| ||||||||||||||| ||||||| |
|
|
| T |
28390451 |
atcactcacaaatattggtcccgtatatttgatttatatttatcacccacaaat |
28390398 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 3 - 59
Target Start/End: Original strand, 43488063 - 43488118
Alignment:
| Q |
3 |
tatcactcacaaatatttgtctcgtattttttatttatatttatcactcacaaatat |
59 |
Q |
| |
|
||||||| ||||||||||||| ||||||||||| |||||||||||| | |||||||| |
|
|
| T |
43488063 |
tatcactaacaaatatttgtcccgtatttttta-ttatatttatcagtgacaaatat |
43488118 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University