View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6182_high_23 (Length: 247)
Name: NF6182_high_23
Description: NF6182
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6182_high_23 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 17 - 239
Target Start/End: Complemental strand, 2475233 - 2475012
Alignment:
| Q |
17 |
tatgtatgcttctcaggaagccgattcatttcgatcatgcaaaactttcccaaacaatttctcttttagccattggtgcataccattgatgtatattcag |
116 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2475233 |
tatgtatgcttctcaggaagccaattcatttcgatcatgcaaaactttcccaaacaatttctcttttagccattggtgcataccattgatgtatattcag |
2475134 |
T |
|
| Q |
117 |
tgttagcaaattggatcgagcatttccccgctgttttttctaaactttcaatgaagtcaacaacagatttacctatttgttgttttagattcattagatc |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
2475133 |
tgttagcaaattggatcgagcatttccccgctgttttttctaaac-ttcaatgaagtcaacaaccgatttacctatttgttgttttagattcattagatc |
2475035 |
T |
|
| Q |
217 |
ggttgtcttaatgaattcttctc |
239 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
2475034 |
ggttgtcttaatgaattcttctc |
2475012 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University