View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6182_low_17 (Length: 271)
Name: NF6182_low_17
Description: NF6182
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6182_low_17 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 231; Significance: 1e-127; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 20 - 262
Target Start/End: Complemental strand, 5445192 - 5444950
Alignment:
| Q |
20 |
tgtttcgccacactgcaatgcagctgtagcttgtaccaaggtcaatgcctatggctttgctttttcttgttgccattgcacttaatttgagaggagagaa |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5445192 |
tgtttcgccacactgcaatgcagctgtagcttgtaccaaggtcaatgcctatggctttgctttttcttgttgccattgcacttaatttgagaggagagaa |
5445093 |
T |
 |
| Q |
120 |
caaaagaagaatggcgttttggttagtgaactgagaatatggatctgattgatcaaaaggtagtttttataggcctaagagaacatttttcagaaaagtt |
219 |
Q |
| |
|
|||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
5445092 |
caaaagaagaatggtgttttggttagtgaaccgagaatatggatctgattgatcaaaaggtagtttttataggcataagagaacatttttcagaaaagtt |
5444993 |
T |
 |
| Q |
220 |
ggggaatgaggaaggagtatggaaaatatacacggagaataat |
262 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5444992 |
ggggaatgaggaaggagtatggaaaatatacacggagaataat |
5444950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 105 - 177
Target Start/End: Original strand, 5441111 - 5441182
Alignment:
| Q |
105 |
tttgagaggagagaacaaaagaagaatggcgttttggttagtgaactgagaatatggatctgattgatcaaaa |
177 |
Q |
| |
|
||||||||||||||||||||||| |||| ||||||| |||| |||||| ||| ||||| |||||||| |||| |
|
|
| T |
5441111 |
tttgagaggagagaacaaaagaa-aatgatgttttgggtagtaaactgaaaatctggatgtgattgataaaaa |
5441182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University