View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6182_low_19 (Length: 254)
Name: NF6182_low_19
Description: NF6182
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6182_low_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 1 - 237
Target Start/End: Complemental strand, 53992949 - 53992714
Alignment:
| Q |
1 |
attctatatttgagatttgtatgt--gttcattgtaaatgttgttttagtctcatgcataaacatatcgatttattcaaccnnnnnnnnnnnnnnggaga |
98 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
53992949 |
attctatatttgagatttgtatgttcgttcattgtaaatgttgttttagtctgatgcataaacatatcgatttattcaaccaaaaaaaaaaaa---gaga |
53992853 |
T |
 |
| Q |
99 |
aaaacatgatctagtaagtacatgctatgaagcgacattaacatgcaggaacgaaatttcactgcactgaactggagttggactaactgaatggtcacat |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53992852 |
aaaacatgatctagtaagtacatgctatgaagcgacattaacatgcaggaacgaaatttcactgcactgaactggagttggactaactgaatggtcacat |
53992753 |
T |
 |
| Q |
199 |
tcatttttgtaccactaaagtgatttcataagtacaaac |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53992752 |
tcatttttgtaccactaaagtgatttcataagtacaaac |
53992714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University