View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6182_low_28 (Length: 228)
Name: NF6182_low_28
Description: NF6182
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6182_low_28 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 100; Significance: 1e-49; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 16 - 127
Target Start/End: Original strand, 43070385 - 43070496
Alignment:
| Q |
16 |
aggggtgaagatagactcatccatgctttaattaattcttgttcttgagtcttaaatcattaacggatcaagacaaaagacaaagagatacatgttttag |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
43070385 |
aggggtgaagatagactcatccatgctttaattaattcttgttcttgagtctttaatcattaacggatgcagacaaaagacaaagagatacatgttttag |
43070484 |
T |
|
| Q |
116 |
agacataagggc |
127 |
Q |
| |
|
|||||||||||| |
|
|
| T |
43070485 |
agacataagggc |
43070496 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 138 - 211
Target Start/End: Original strand, 43070517 - 43070591
Alignment:
| Q |
138 |
aagacatgatcactaactcatgtgattgtg-nnnnnnnnnctttacagcacacattaattattttcttctaaact |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
43070517 |
aagacatgatcactaactcatgtgattgtgttttttttttctttacagcacacattaatttttttcttctaaact |
43070591 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University