View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6183_high_3 (Length: 296)
Name: NF6183_high_3
Description: NF6183
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6183_high_3 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 18 - 282
Target Start/End: Complemental strand, 47119308 - 47119044
Alignment:
| Q |
18 |
tttagaaagtccactaggacgccctgagtttgctctagcagatggaggttgatcattgttcacattattggattgagccgatcgagacatagctaaactg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47119308 |
tttagaaagtccactaggacgccctgagtttgctctagcagatggaggttgatcattgttcacattattggattgagccgatcgagacatagctaaactg |
47119209 |
T |
|
| Q |
118 |
cgtgcagagggagacaaatcaaaggttcgatttgtcgttgttgaacgagcagagggtggttgttgctccccctgattggcatgcgtggagattcgtggtg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47119208 |
cgtgcagagggagacaaatcaaaggttcgatttgtcgttgttgaacgagcagagggtggttgttgctccccctgattggcatgcgtggagattcgtggtg |
47119109 |
T |
|
| Q |
218 |
gagtttgctcagcagtatttgcagagaaagacgatcgaacactagatatagttcttaaagattga |
282 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47119108 |
gagtttgctcagcagtatttgcagagaaagacgatcgaacactagatatagttcttaaagattga |
47119044 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University