View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6184_high_14 (Length: 419)
Name: NF6184_high_14
Description: NF6184
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6184_high_14 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 162; Significance: 2e-86; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 223 - 409
Target Start/End: Complemental strand, 2651477 - 2651295
Alignment:
| Q |
223 |
aaataaattattcttactgacaaaatgaaccgtttaccatatccacatggttgctggggactgtctgtcactcccaacggtcaccaaacgacccaatctt |
322 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
2651477 |
aaataaattattcttacggacaaaatgaaccgtttaccttatccacatggttgctggggactgtc----actcccaacggtcaccaaacgacccaatctt |
2651382 |
T |
 |
| Q |
323 |
ctgcctcagactttcctatcctaccgttaatcactttgccctttttcatcttctcaatggaagccagctccccattttacttttctt |
409 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2651381 |
ctgcctcagactttcctatcctaccgttaatcactttgccctttttcatcttctcaatggaagccagctccccattttacttttctt |
2651295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 92 - 163
Target Start/End: Complemental strand, 2651556 - 2651480
Alignment:
| Q |
92 |
gcagcgttaaaactcttaaaaagt-----ctacccaattagatcatacaatgatcgagagattaatcatcgcagttg |
163 |
Q |
| |
|
||||||||||||||||||||||| ||| ||||||||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
2651556 |
gcagcgttaaaactcttaaaaagaatttgctatccaattagatcatacaatgctcgaaagattaatcatcgcagttg |
2651480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University