View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6184_high_22 (Length: 314)
Name: NF6184_high_22
Description: NF6184
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6184_high_22 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 258; Significance: 1e-144; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 258; E-Value: 1e-144
Query Start/End: Original strand, 13 - 314
Target Start/End: Complemental strand, 1005740 - 1005439
Alignment:
| Q |
13 |
taggtgtaattctggatagaaatgtactgatatatgaatttattgttcttttatggtatgttgttacatttttccccggtcagaccagagcagtcaaagg |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
1005740 |
taggtgtaattctggatagaaatgtactgatatatgaatttattgttcttttatggtatgttgttacatttttccctggtcagaccagagcagtcaaagg |
1005641 |
T |
 |
| Q |
113 |
cataccttaggcttagcaccttattgaaaactgtaaaccccagaaagcacagtcacctaaactgctaagttctcactgtggtgcagaaggggtaacttta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1005640 |
cataccttaggcttagcaccttattgaaaactgtaaaccccagaaagcacagtcacctaaactgctaagttctcactgtggtgcagaaggggtaacttta |
1005541 |
T |
 |
| Q |
213 |
aatggtcagatagttgaactataactgatccaatgttttgtttatctcacaagctagcactttcttatttgatgttgagtttgtctgattgtcaggggat |
312 |
Q |
| |
|
||||||||||||||||||||||||||||| || |||||||||| ||||||| | ||| |||||||||| ||||||| ||| | ||||||||||||||||| |
|
|
| T |
1005540 |
aatggtcagatagttgaactataactgatacattgttttgtttttctcacatgttagtactttcttatatgatgtttagtatttctgattgtcaggggat |
1005441 |
T |
 |
| Q |
313 |
ac |
314 |
Q |
| |
|
|| |
|
|
| T |
1005440 |
ac |
1005439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University