View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6184_low_18 (Length: 347)
Name: NF6184_low_18
Description: NF6184
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6184_low_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 326; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 326; E-Value: 0
Query Start/End: Original strand, 6 - 335
Target Start/End: Original strand, 1534031 - 1534360
Alignment:
| Q |
6 |
atggacatcatcaaccaaacataaaacctaaatccaaacgagtattaaattcatgcaaccaattcagatatccaatatccttcaagtatgttctgttgtc |
105 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1534031 |
atggccatcatcaaccaaacataaaacctaaatccaaacgagtattaaattcatgcaaccaattcagatatccaatatccttcaagtatgttctgttgtc |
1534130 |
T |
 |
| Q |
106 |
atagccttccaattgcaagggggctttcgatgctcagccttcgtcaaactagctagaacttggattttcttattttagaatgcctctttttcattgatgc |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1534131 |
atagccttccaattgcaagggggctttcgatgctcagccttcgtcaaactagctagaacttggattttcttattttagaatgcctctttttcattgatgc |
1534230 |
T |
 |
| Q |
206 |
ttcgtctcctcaaacatcatgctttgtgctcacttcaagagatttccaattctctttctcattccaaatgacaccttatcctcttttcttaaaatgtacc |
305 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1534231 |
ttcgtctcctcaaacatcatgctttgtgctcacttcaagagatttccaattctctttctcattccaaatgacaccttatcctcttttcttaaaatgtacc |
1534330 |
T |
 |
| Q |
306 |
cctcacaatccctacccttgttcttcttga |
335 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
1534331 |
cctcacaatccctacccttgttcttcttga |
1534360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University