View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6184_low_29 (Length: 252)
Name: NF6184_low_29
Description: NF6184
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6184_low_29 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 20 - 239
Target Start/End: Complemental strand, 25029612 - 25029393
Alignment:
| Q |
20 |
tagcggctgtggactgtggtagattgatcgctgttggttcttgtttgaaagaaaaatcttgtgcttaagatcaaccttgtcattaatttcaattaacttc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
25029612 |
tagcggctgtggactgtggtagattgatcgctgttggttcttgtttgaaagaaaaatcttgtgcttaagatcaaccttttcattaatttcaattaacttc |
25029513 |
T |
 |
| Q |
120 |
catcccgtttaccacacctagaagattagtcatgttttatcatgtgtcgaatttatataccttcattttctgtctgattccatgaaaaaatttcagactg |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25029512 |
catcccgtttaccacacctagaagattagtcatgttttatcatgtgtcgaatttatataccttcattttctgtctgattccatgaaaaaatttcagactg |
25029413 |
T |
 |
| Q |
220 |
ctttttcccattcaacacct |
239 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
25029412 |
ctttttcccattcaacacct |
25029393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University