View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6184_low_38 (Length: 223)
Name: NF6184_low_38
Description: NF6184
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6184_low_38 |
 | |
|
| [»] chr5 (3 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 210; Significance: 1e-115; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 6 - 223
Target Start/End: Original strand, 1004930 - 1005147
Alignment:
| Q |
6 |
aatcccatccatgaagtaaacgggatgagagagcctcgactacttgggattgggatatgcttcatgtaatcctgatacattgccgcccgtcttgtgagtg |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1004930 |
aatcccatccatgaagtaaacgggatgagagagcctcgactacttgggattgggatatgcttcatgtaatcctgatacattgccgcccgtcttgtgagtg |
1005029 |
T |
|
| Q |
106 |
catctgtgtataatcatgactttttaaataagtgaattcataggaataggaagcagactaagattaaaaaattaattgagaaagccacactcgtgctgtc |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| || |
|
|
| T |
1005030 |
catctgtgtataatcatgactttttaaataagtgaattcataggaataggaagcagactaagattaaaaaattaattgagaaagccacacacgtgctatc |
1005129 |
T |
|
| Q |
206 |
tagaaaccaataagacaa |
223 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
1005130 |
tagaaaccaataagacaa |
1005147 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 9 - 124
Target Start/End: Original strand, 996088 - 996203
Alignment:
| Q |
9 |
cccatccatgaagtaaacgggatgagagagcctcgactacttgggattgggatatgcttcatgtaatcctgatacattgccgcccgtcttgtgagtgcat |
108 |
Q |
| |
|
||||||||||| ||||| || |||| |||||||||||||| ||||||||||| |||| |||||||||||| |||||||| |||||||| ||||| ||| |
|
|
| T |
996088 |
cccatccatgaggtaaatggaatgactgagcctcgactactcgggattgggatctgctccatgtaatcctggtacattgctgcccgtctgatgagtacat |
996187 |
T |
|
| Q |
109 |
ctgtgtataatcatga |
124 |
Q |
| |
|
||| ||||| ||||| |
|
|
| T |
996188 |
ctgcatataagcatga |
996203 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 6 - 97
Target Start/End: Original strand, 992164 - 992255
Alignment:
| Q |
6 |
aatcccatccatgaagtaaacgggatgagagagcctcgactacttgggattgggatatgcttcatgtaatcctgatacattgccgcccgtct |
97 |
Q |
| |
|
|||||||||||| | ||| | || |||| |||||||||||| | |||||||||| |||| |||||||| |||||||||||| |||||||| |
|
|
| T |
992164 |
aatcccatccataaggtagatggaatgaccgagcctcgactagtcaggattgggatctgctccatgtaattctgatacattgctgcccgtct |
992255 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University