View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6184_low_40 (Length: 218)
Name: NF6184_low_40
Description: NF6184
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6184_low_40 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 18 - 199
Target Start/End: Complemental strand, 41112756 - 41112575
Alignment:
| Q |
18 |
caaccaaccataaatgggctgtttcaactctaagccaacaagacagtatcctgggaaagaggatcccgtgattcttgcatcacagactgcttgtaagtcg |
117 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41112756 |
caaccaaccataaatgggctgcttcaactctaagccaacaagacagtatcctgggaaagaggatcccgtgattcttgcatcacagactgcttgtaagtcg |
41112657 |
T |
 |
| Q |
118 |
atttgatcttatgctttagttttgtgtagttattggattgtgggctgttgcgattcgatctgtttactgaattttgagttta |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41112656 |
atttgatcttatgctttagttttgtgtagttattggattgtgggctgttgcgattcgatctgtttactgaattttgagttta |
41112575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University