View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6185_high_11 (Length: 250)
Name: NF6185_high_11
Description: NF6185
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6185_high_11 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 10 - 250
Target Start/End: Original strand, 52157488 - 52157726
Alignment:
| Q |
10 |
ataattctagcgtacacgtatggaatgctttatattactgcgtgattatatgcataaagttttcttcattcaaagagtaggggagccctaggttatcagc |
109 |
Q |
| |
|
||||||||||||||||| |||||||||||| ||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52157488 |
ataattctagcgtacac--atggaatgctttttattactgcgtgattatatgcttaaatttttcttcattcaaagagtaggggagccctaggttatcagc |
52157585 |
T |
|
| Q |
110 |
agagtaccctgcttggattgtccaacatcagctatcttcataacataacgatttgtatggaagaaaaatatggaacattaccaacgtaaacgtacatcca |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52157586 |
agagtaccctgcttggattgtccaacatcagctatcttcataacataacgatttgtatggaagaaaaatatggaacattaccaacgtaaacgtacatcca |
52157685 |
T |
|
| Q |
210 |
ctgggatcatttgttacaacttccacttttgagagatgctt |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52157686 |
ctgggatcatttgttacaacttccacttttgagagatgctt |
52157726 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 178 - 248
Target Start/End: Original strand, 6555556 - 6555626
Alignment:
| Q |
178 |
tatggaacattaccaacgtaaacgtacatccactgggatcatttgttacaacttccacttttgagagatgc |
248 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||| ||||| ||||||| |||||| |||||||| |||||| |
|
|
| T |
6555556 |
tatggaacattaccagtgtaaatgtacatccactaggatcgtttgttaaaacttctacttttgaaagatgc |
6555626 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University