View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6185_low_3 (Length: 427)
Name: NF6185_low_3
Description: NF6185
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6185_low_3 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 388; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 388; E-Value: 0
Query Start/End: Original strand, 12 - 407
Target Start/End: Original strand, 34885227 - 34885622
Alignment:
| Q |
12 |
atgaacattggaaccgttaaaagcgtcatgaacagcatcaaaagaagattgatgagcgaagatatgaatctgacaagggatacggaatttgttattgtta |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34885227 |
atgaacattggaaccgttaaaagcgtcatgaacagcatcaaaagaagattgatgagcgaagatatgaatctgacaagggatacggaatttgttattgtta |
34885326 |
T |
 |
| Q |
112 |
gagcggggttgaacgatggcttcgacgtggatgatgtgagcgtcgaggagaggagcgagagcggaggcgacggagcgttcgatgtaaccgacttggagcg |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||| |
|
|
| T |
34885327 |
gagcggggttgaacgatggcttcgacgtggatgatgtgagcgtcgaggagaggagcgagagcggaggcaacggcgcgttcgatgtaaccgacttggagcg |
34885426 |
T |
 |
| Q |
212 |
tttgagtgttgaggactttgatggcgttggaatcgtatgggtttaaaggttcgcggattaagccgaggatttcgcgaccggtgatggtgccggagtagtg |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34885427 |
tttgagtgttgaggactttgatggcgttggaatcgtatgggtttaaaggttcgcggattaagccgaggatttcgcgaccggtgatggtgccggagtagtg |
34885526 |
T |
 |
| Q |
312 |
tttaatgccgacgatgttggccattacgaaaccggcgaggtaggtttcggattgggattgagagaagggttcttgtgagtcttccatggtgattgg |
407 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34885527 |
tttaatgccgacgatgttggccattacgaaaccggcgaggtaggtttcggattgggattgagagaagggttcttgtgagtcttccatggtgattgg |
34885622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University