View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6185_low_6 (Length: 315)
Name: NF6185_low_6
Description: NF6185
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6185_low_6 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 18 - 306
Target Start/End: Original strand, 8846330 - 8846629
Alignment:
| Q |
18 |
cctatgacggtatattttctttgacatttaacaaattggttgcaaatagtgatggaa-----------taggcttttgccaatcattgaaaacttcttat |
106 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
8846330 |
cctatgacggtatattttctttaacatttaacaaattggttgcaaatagtgatggaaataaagatgcataggcttttgccaatcattgaaaacttcttat |
8846429 |
T |
|
| Q |
107 |
attgatgttgcaggtgtgacacatgtgggaggagatatgtttgagagtgttcctgatggagatgtcttatttttgaaggtgaattcaagcttttatatta |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
8846430 |
attgatgttgcaggtgtgacacatgtgggaggagatatgtttgagagtgttcctgatggagatgtcatatttttgaaggtgaattcaagcttttatatta |
8846529 |
T |
|
| Q |
207 |
ataatctatttaatttttctttaacatttaatagttctttcaaacgattcatcttttagtgaaactcattaactactcgaattcaatcagttagtattat |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||| |
|
|
| T |
8846530 |
ataatctatttaatttttctttaacatttaatagttctttcaaacgattcatcttttagtgaaacacattaactactcgaattcaatcagttagtcttat |
8846629 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 118 - 170
Target Start/End: Complemental strand, 49098393 - 49098341
Alignment:
| Q |
118 |
aggtgtgacacatgtgggaggagatatgtttgagagtgttcctgatggagatg |
170 |
Q |
| |
|
||||||| ||||||||| ||||||||||||||||| ||||||| ||| |||| |
|
|
| T |
49098393 |
aggtgtggaacatgtggggggagatatgtttgagagcgttcctgctggggatg |
49098341 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University