View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6185_low_8 (Length: 298)
Name: NF6185_low_8
Description: NF6185
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6185_low_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 181; Significance: 8e-98; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 181; E-Value: 8e-98
Query Start/End: Original strand, 1 - 280
Target Start/End: Complemental strand, 43016849 - 43016544
Alignment:
| Q |
1 |
aattgattgctttgggagctctctcctgtttcttgcattcagttttctgtacaaaaaacagtttccagaggtgtcttggacttcttgtaagtgtggattt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43016849 |
aattgattgctttgggagctctctcctgtttcttgcattcagttttctgtacaaaaaacagtttccagaggtgtcttggacttcttgtaagtgtggattt |
43016750 |
T |
 |
| Q |
101 |
ttctttggtaaatat---------------------agtaaaatgtggcacacatatggctgtttcaagataacaaaaacagattatctataataatgat |
179 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43016749 |
ttctttggtaaatatagtgtaaataaagctactaaaagtaaaatgtggcacacatatggctgtttcaagataacaaaaacagattatctataataatgat |
43016650 |
T |
 |
| Q |
180 |
tttnnnnnnnta-----gttattttagccgaagcgtggcagagtgtgttgagatatttagtttagttttcctacttttgttttcatgaaaatacggttta |
274 |
Q |
| |
|
||| || |||||||||||| ||||||| |||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
43016649 |
tttaaaaaaatagtaacgttattttagcccaagcgtgacagagtgtgtggagatatttagtttagtttgcctacttttgttttcatgaaaatacggttta |
43016550 |
T |
 |
| Q |
275 |
catcta |
280 |
Q |
| |
|
|||||| |
|
|
| T |
43016549 |
catcta |
43016544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University