View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6185_low_9 (Length: 286)
Name: NF6185_low_9
Description: NF6185
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6185_low_9 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 18 - 281
Target Start/End: Complemental strand, 54723 - 54460
Alignment:
| Q |
18 |
gcatttacattgtcatcgttaaaaagggagacaagtaattcttcttgatgattggatgaggccataggggcagcctgcacaacgtttctaacaaatccag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54723 |
gcatttacattgtcatcgttaaaaagggagacaagtaattcttcttgatgattggatgaggccataggggcagcctgcacaacgtttctaacaaatccag |
54624 |
T |
|
| Q |
118 |
agggtgcccttttgtcataggctccataggcataaggatagtacacaagttgctgttcaacataaggccaaaattgagctcttactttcccagtgctttt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54623 |
agggtgcccttttgtcataggctccataggcataaggatagtacacaagttgctgttcaacataaggccaaaattgagctcttactttcccagtgctttt |
54524 |
T |
|
| Q |
218 |
tattctctttaacaccttgtttggatcaacataaccacttactatcaccctgctttgctctctg |
281 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
54523 |
tattctctttaacaccttgtttggatcaacataaccacttactatcaccctgctttgctttctg |
54460 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 176 - 276
Target Start/End: Complemental strand, 31888494 - 31888394
Alignment:
| Q |
176 |
aacataaggccaaaattgagctcttactttcccagtgctttttattctctttaacaccttgtttggatcaacataaccacttactatcaccctgctttgc |
275 |
Q |
| |
|
||||||||||||||||| ||||||| |||||||||||| ||| ||| || |||||| |||||||||||||| ||||| | ||| | ||| |||||||| |
|
|
| T |
31888494 |
aacataaggccaaaattcagctcttttcttcccagtgcttcttactcttttcaacaccatgtttggatcaacaaaaccattcactgttaccttgctttgc |
31888395 |
T |
|
| Q |
276 |
t |
276 |
Q |
| |
|
| |
|
|
| T |
31888394 |
t |
31888394 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University