View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6187_high_12 (Length: 249)
Name: NF6187_high_12
Description: NF6187
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6187_high_12 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 205; Significance: 1e-112; HSPs: 7)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 237
Target Start/End: Complemental strand, 8653135 - 8652900
Alignment:
| Q |
1 |
atgtagttatgtgtcagtgtcggatgtctaacatgtattggtgtcagacacatacatgtagtttacctttggtatctacatgtcagtgtcatatctggta |
100 |
Q |
| |
|
||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||| ||| |
|
|
| T |
8653135 |
atgtagttatgtgtcagtgtcgggtgtctgacatgtattggtgtcagacacatacatgtagtt-acctttggtatctatgtgtcagtgtcatatccagta |
8653037 |
T |
|
| Q |
101 |
tatgtatctgtattgctgcttcatagattattgtgtaggatgccgttccggtgcctgacacgtatttgtgtcagacacaagcacatgtagttacgtttgg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8653036 |
tatgtatctgtattgctgcttcatagattattgtgtaggatgccgttccggtgcctgacacgtatttgtgtcagacacaagcacatgtagttacgtttgg |
8652937 |
T |
|
| Q |
201 |
tttctatgtgtcagtgtcatatccggtatatgtgtct |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8652936 |
tttctatgtgtcagtgtcatatccggtatatgtgtct |
8652900 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 36 - 245
Target Start/End: Original strand, 9173170 - 9173380
Alignment:
| Q |
36 |
tattggtgtcagacacataca--tgtagtttacctttggtatctacatgtcagtgtcatatctggtatatgtatctgtattgctgcttcatagattattg |
133 |
Q |
| |
|
||||||||| ||||||||||| ||||||| ||||||||||||||| ||||||||||||||| |||||| ||||||||||||||||||||| ||||||| |
|
|
| T |
9173170 |
tattggtgttagacacatacacatgtagtt-acctttggtatctacgtgtcagtgtcatatccggtatacttatctgtattgctgcttcatatattattg |
9173268 |
T |
|
| Q |
134 |
tgtaggatgccgttccggtgcctgacacgtatttgtgtcagacacaagcacatgtagttacgtttggtttctatgtgtcagtgtcatatccggtatatgt |
233 |
Q |
| |
|
| |||| |||||||| ||||||||||| ||| |||| |||||| | || |||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
9173269 |
tttagggtgccgttcatgtgcctgacacatatctgtgccagacataggcgcatgtagttacgtttggtttctatgtgtcaatgtcatatccggtatatgt |
9173368 |
T |
|
| Q |
234 |
gtctgtgctgct |
245 |
Q |
| |
|
||| ||| |||| |
|
|
| T |
9173369 |
gtccgtgttgct |
9173380 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 150 - 239
Target Start/End: Complemental strand, 8653113 - 8653026
Alignment:
| Q |
150 |
ggtgcctgacacgtatttgtgtcagacacaagcacatgtagttacgtttggtttctatgtgtcagtgtcatatccggtatatgtgtctgt |
239 |
Q |
| |
|
|||| |||||| ||||| |||||||||||| |||||||||||| |||||| |||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
8653113 |
ggtgtctgacatgtattggtgtcagacacat--acatgtagttacctttggtatctatgtgtcagtgtcatatccagtatatgtatctgt |
8653026 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 150 - 230
Target Start/End: Original strand, 9173157 - 9173237
Alignment:
| Q |
150 |
ggtgcctgacacgtatttgtgtcagacacaagcacatgtagttacgtttggtttctatgtgtcagtgtcatatccggtata |
230 |
Q |
| |
|
|||| ||||||| |||| |||| ||||||| ||||||||||||| |||||| |||| ||||||||||||||||||||||| |
|
|
| T |
9173157 |
ggtgtctgacacatattggtgttagacacatacacatgtagttacctttggtatctacgtgtcagtgtcatatccggtata |
9173237 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 35 - 131
Target Start/End: Complemental strand, 8652975 - 8652878
Alignment:
| Q |
35 |
gtattggtgtcagacacat--acatgtagtttacctttggtatctacatgtcagtgtcatatctggtatatgtatctgtattgctgcttcatagattat |
131 |
Q |
| |
|
||||| |||||||||||| |||||||||| || |||||| |||| ||||||||||||||| ||||||||| ||| | ||||||||||||||||||| |
|
|
| T |
8652975 |
gtatttgtgtcagacacaagcacatgtagtt-acgtttggtttctatgtgtcagtgtcatatccggtatatgtgtctttgttgctgcttcatagattat |
8652878 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 63 - 131
Target Start/End: Original strand, 9173326 - 9173394
Alignment:
| Q |
63 |
ttacctttggtatctacatgtcagtgtcatatctggtatatgtatctgtattgctgcttcatagattat |
131 |
Q |
| |
|
|||| |||||| |||| ||||| ||||||||| ||||||||| || || ||||||||||||||||||| |
|
|
| T |
9173326 |
ttacgtttggtttctatgtgtcaatgtcatatccggtatatgtgtccgtgttgctgcttcatagattat |
9173394 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 168 - 225
Target Start/End: Original strand, 9173058 - 9173115
Alignment:
| Q |
168 |
gtgtcagacacaagcacatgtagttacgtttggtttctatgtgtcagtgtcatatccg |
225 |
Q |
| |
|
|||| |||||||| |||| ||||||||||||||| |||||| ||| ||||| |||||| |
|
|
| T |
9173058 |
gtgttagacacaaacacacgtagttacgtttggtatctatgcgtcggtgtcgtatccg |
9173115 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University