View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6187_high_18 (Length: 226)
Name: NF6187_high_18
Description: NF6187
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6187_high_18 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 80; Significance: 1e-37; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 37 - 128
Target Start/End: Complemental strand, 5212021 - 5211930
Alignment:
| Q |
37 |
ctagcatagccctcacaatcacaacaactgtcgtttataaaattcttaggtcataattattagaaacttttgttaatccaacaaaagaagat |
128 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5212021 |
ctagtatagccctcacaatcacaacaactgtcgtttataaagttcttagatcataattattagaaacttttgttaatccaacaaaagaagat |
5211930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University