View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6187_low_14 (Length: 249)

Name: NF6187_low_14
Description: NF6187
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6187_low_14
NF6187_low_14
[»] chr5 (7 HSPs)
chr5 (1-237)||(8652900-8653135)
chr5 (36-245)||(9173170-9173380)
chr5 (150-239)||(8653026-8653113)
chr5 (150-230)||(9173157-9173237)
chr5 (35-131)||(8652878-8652975)
chr5 (63-131)||(9173326-9173394)
chr5 (168-225)||(9173058-9173115)


Alignment Details
Target: chr5 (Bit Score: 205; Significance: 1e-112; HSPs: 7)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 237
Target Start/End: Complemental strand, 8653135 - 8652900
Alignment:
1 atgtagttatgtgtcagtgtcggatgtctaacatgtattggtgtcagacacatacatgtagtttacctttggtatctacatgtcagtgtcatatctggta 100  Q
    ||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||| ||||||||||||||  |||||||||||||||  |||    
8653135 atgtagttatgtgtcagtgtcgggtgtctgacatgtattggtgtcagacacatacatgtagtt-acctttggtatctatgtgtcagtgtcatatccagta 8653037  T
101 tatgtatctgtattgctgcttcatagattattgtgtaggatgccgttccggtgcctgacacgtatttgtgtcagacacaagcacatgtagttacgtttgg 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8653036 tatgtatctgtattgctgcttcatagattattgtgtaggatgccgttccggtgcctgacacgtatttgtgtcagacacaagcacatgtagttacgtttgg 8652937  T
201 tttctatgtgtcagtgtcatatccggtatatgtgtct 237  Q
    |||||||||||||||||||||||||||||||||||||    
8652936 tttctatgtgtcagtgtcatatccggtatatgtgtct 8652900  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 36 - 245
Target Start/End: Original strand, 9173170 - 9173380
Alignment:
36 tattggtgtcagacacataca--tgtagtttacctttggtatctacatgtcagtgtcatatctggtatatgtatctgtattgctgcttcatagattattg 133  Q
    ||||||||| |||||||||||  ||||||| ||||||||||||||| ||||||||||||||| ||||||  ||||||||||||||||||||| |||||||    
9173170 tattggtgttagacacatacacatgtagtt-acctttggtatctacgtgtcagtgtcatatccggtatacttatctgtattgctgcttcatatattattg 9173268  T
134 tgtaggatgccgttccggtgcctgacacgtatttgtgtcagacacaagcacatgtagttacgtttggtttctatgtgtcagtgtcatatccggtatatgt 233  Q
    | |||| ||||||||  ||||||||||| ||| |||| |||||| | || |||||||||||||||||||||||||||||| |||||||||||||||||||    
9173269 tttagggtgccgttcatgtgcctgacacatatctgtgccagacataggcgcatgtagttacgtttggtttctatgtgtcaatgtcatatccggtatatgt 9173368  T
234 gtctgtgctgct 245  Q
    ||| ||| ||||    
9173369 gtccgtgttgct 9173380  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 150 - 239
Target Start/End: Complemental strand, 8653113 - 8653026
Alignment:
150 ggtgcctgacacgtatttgtgtcagacacaagcacatgtagttacgtttggtttctatgtgtcagtgtcatatccggtatatgtgtctgt 239  Q
    |||| |||||| ||||| ||||||||||||   |||||||||||| |||||| |||||||||||||||||||||| |||||||| |||||    
8653113 ggtgtctgacatgtattggtgtcagacacat--acatgtagttacctttggtatctatgtgtcagtgtcatatccagtatatgtatctgt 8653026  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 150 - 230
Target Start/End: Original strand, 9173157 - 9173237
Alignment:
150 ggtgcctgacacgtatttgtgtcagacacaagcacatgtagttacgtttggtttctatgtgtcagtgtcatatccggtata 230  Q
    |||| ||||||| |||| |||| |||||||  ||||||||||||| |||||| |||| |||||||||||||||||||||||    
9173157 ggtgtctgacacatattggtgttagacacatacacatgtagttacctttggtatctacgtgtcagtgtcatatccggtata 9173237  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 35 - 131
Target Start/End: Complemental strand, 8652975 - 8652878
Alignment:
35 gtattggtgtcagacacat--acatgtagtttacctttggtatctacatgtcagtgtcatatctggtatatgtatctgtattgctgcttcatagattat 131  Q
    ||||| ||||||||||||   |||||||||| || |||||| ||||  ||||||||||||||| ||||||||| ||| | |||||||||||||||||||    
8652975 gtatttgtgtcagacacaagcacatgtagtt-acgtttggtttctatgtgtcagtgtcatatccggtatatgtgtctttgttgctgcttcatagattat 8652878  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 63 - 131
Target Start/End: Original strand, 9173326 - 9173394
Alignment:
63 ttacctttggtatctacatgtcagtgtcatatctggtatatgtatctgtattgctgcttcatagattat 131  Q
    |||| |||||| ||||  ||||| ||||||||| ||||||||| || || |||||||||||||||||||    
9173326 ttacgtttggtttctatgtgtcaatgtcatatccggtatatgtgtccgtgttgctgcttcatagattat 9173394  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 168 - 225
Target Start/End: Original strand, 9173058 - 9173115
Alignment:
168 gtgtcagacacaagcacatgtagttacgtttggtttctatgtgtcagtgtcatatccg 225  Q
    |||| |||||||| |||| ||||||||||||||| |||||| ||| ||||| ||||||    
9173058 gtgttagacacaaacacacgtagttacgtttggtatctatgcgtcggtgtcgtatccg 9173115  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University