View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6187_low_9 (Length: 303)
Name: NF6187_low_9
Description: NF6187
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6187_low_9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 29 - 284
Target Start/End: Original strand, 26529232 - 26529488
Alignment:
| Q |
29 |
aaaatcacgccgattagaatcttctggttacttgacactagaattcaaactccaatcttcttaatgtagtctttagtcaatttgcatcaagaaaaagaca |
128 |
Q |
| |
|
||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||| |
|
|
| T |
26529232 |
aaaatcatgccgattagaatcttctagttacttgacactagaattcaaactccaatcttcttaacgtagtctttagtccatttgcatcaagaaaaagaca |
26529331 |
T |
|
| Q |
129 |
ttgacacctagcaatctttccc-atcattgcaatcaccttttcaactgagtttgatctaaccctcttgcggtcagtacctgcctatgcagataatgttct |
227 |
Q |
| |
|
| ||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
26529332 |
tccacacctagcaatctttccccatcatggcaatcaccttttcaactgagtttgatctaaccctcttgcggtcagttcctgcctatgcagataatgttct |
26529431 |
T |
|
| Q |
228 |
tcaaacgagaacctttataagaagactcctagttgtagtctacagtatcttagccga |
284 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| |||||| |||||||||||| |
|
|
| T |
26529432 |
tcaaacgagaacctttataagaaagctcctagttgtaatctacaatatcttagccga |
26529488 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University