View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6188_high_21 (Length: 250)
Name: NF6188_high_21
Description: NF6188
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6188_high_21 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 99; Significance: 6e-49; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 91 - 241
Target Start/End: Complemental strand, 1814378 - 1814229
Alignment:
| Q |
91 |
tgaggggacaaggacaatttctagtttcagtttattgcttgactcaccaattttggaatataacagtggattagcatataagtgagcatatcatagcacn |
190 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
1814378 |
tgaggggacaaggacaatttctagttgcagtttattgcttaactcaccaatgttggaatataacagtggattagcatataagtgagcatatcaaagcac- |
1814280 |
T |
|
| Q |
191 |
nnnnnnnnggagtttataaaaaagataacaaccaaccacaagtctcctatg |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
1814279 |
aaaaaaaaggagtttataaaaaagataacaaccaaccacaagtcacctatg |
1814229 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 204 - 240
Target Start/End: Complemental strand, 1829526 - 1829490
Alignment:
| Q |
204 |
ttataaaaaagataacaaccaaccacaagtctcctat |
240 |
Q |
| |
|
|||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
1829526 |
ttataacaaagataacaaccaaccacaagtcacctat |
1829490 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University