View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6188_high_30 (Length: 237)
Name: NF6188_high_30
Description: NF6188
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6188_high_30 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 210
Target Start/End: Original strand, 5331718 - 5331927
Alignment:
| Q |
1 |
aaagtaagtcacgaaactctcacgctgaatgaatagtcttgtaagattcgacttttctcataggcttaagtcatacctacggtctactagtgcttttctt |
100 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
5331718 |
aaagtaagtcacgaaactctcacgctaaatgaatagtcttgtaagattcgacttttctcataggcttaagtcataactacggtctactagtgcttttctt |
5331817 |
T |
 |
| Q |
101 |
gagagttaagttacgtaaaaggcggcctatagactttattaaggttcaccattgaataccaatagacgagtgaagctgccaaagaggaaatgactaccat |
200 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5331818 |
gagagttaagttacgtaacgggcggcctatagactttattaaggttcaccattgaataccaatagacgagtgaagctgccaaagaggaaatgactaccat |
5331917 |
T |
 |
| Q |
201 |
cgtccaccag |
210 |
Q |
| |
|
|||||||||| |
|
|
| T |
5331918 |
cgtccaccag |
5331927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University