View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6188_low_32 (Length: 222)
Name: NF6188_low_32
Description: NF6188
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6188_low_32 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 24 - 217
Target Start/End: Complemental strand, 1315677 - 1315485
Alignment:
| Q |
24 |
cccacacaacaactcaagatacttgaccaacttcattttccaacaccattctactaccaaactttcttggaactcacttcacctatgttgggacgacatt |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
1315677 |
cccacacaacaactcaagatacttgaccaacttcattttccaacaccattctactaccaaactttcttg-aactcacttcacctatgttgggacgacatt |
1315579 |
T |
 |
| Q |
124 |
ttttacaccactatttgcgtaccatcaacctatgctagaagattgtattgtcccatgtcgttgtctaatggattaagacagataaatgatgatg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
1315578 |
ttttacaccactatttgcgtaccatcaacctatgctagaagattgtatcgtcccatgtcgttgtctaatggatcaaggcagataaatgatgatg |
1315485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University