View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6188_low_33 (Length: 212)
Name: NF6188_low_33
Description: NF6188
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6188_low_33 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 1 - 172
Target Start/End: Complemental strand, 32491317 - 32491146
Alignment:
| Q |
1 |
tgagatggataatcatgaaccattctcttgtaatactcttcaagattctcactttcttgcaaatttggcacaaacatatcatcactgataataaaattat |
100 |
Q |
| |
|
|||||||||||||||||||||||| |||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32491317 |
tgagatggataatcatgaaccattatcttataatactcttgaagattctcactttcttgcaaatttggcacaaacatatcatcactgataataaaattat |
32491218 |
T |
 |
| Q |
101 |
tatcagacacaacatcaccaccatcaacaccaagtcctgttgcaagatacataggaggagtagatggttgaa |
172 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||| |||||| |||||||||||||||||||||||| |
|
|
| T |
32491217 |
tatcagacacaacatcaccaccatcaactccaagtcctgtagcaagaaacataggaggagtagatggttgaa |
32491146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University