View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6188_low_9 (Length: 370)
Name: NF6188_low_9
Description: NF6188
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6188_low_9 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 75; Significance: 2e-34; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 167 - 269
Target Start/End: Original strand, 6761813 - 6761915
Alignment:
| Q |
167 |
aacaatctaaaactagaatacataacattatcaatgcaaacagaaagggtacctttacgtacactttttcccttttacagttaataatagctatgaaaat |
266 |
Q |
| |
|
||||||||||||||||| || |||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||| |||||||||||||||| |
|
|
| T |
6761813 |
aacaatctaaaactagactatataacattatcaatgcaaacagaaagggtacctttacgcccactttttcccttttatggttactaatagctatgaaaat |
6761912 |
T |
|
| Q |
267 |
att |
269 |
Q |
| |
|
||| |
|
|
| T |
6761913 |
att |
6761915 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 330 - 366
Target Start/End: Original strand, 6761912 - 6761948
Alignment:
| Q |
330 |
tattaacaagacaaaaatttattccaagtctgttttt |
366 |
Q |
| |
|
|||||||||| | |||||||||||||||||||||||| |
|
|
| T |
6761912 |
tattaacaaggctaaaatttattccaagtctgttttt |
6761948 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 38; Significance: 0.000000000002; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 53 - 117
Target Start/End: Original strand, 26575433 - 26575498
Alignment:
| Q |
53 |
tggtgtgaaagaataaaagaaaacttggt-tttgatgtatttttagaaccgggtaactgatacaaa |
117 |
Q |
| |
|
|||||||||||||||||| ||||||||| ||| |||||||| ||||||||||| ||||||||||| |
|
|
| T |
26575433 |
tggtgtgaaagaataaaaagaaacttggtattttatgtatttatagaaccgggtcactgatacaaa |
26575498 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 137 - 224
Target Start/End: Original strand, 27813470 - 27813556
Alignment:
| Q |
137 |
aaattgatcaaaatatgctactaacagccaaacaatctaaaactagaatacataacattatcaatgcaaacagaaagggtacctttac |
224 |
Q |
| |
|
||||| |||||||| ||| ||||||| | |||||||||||||| ||| || || |||||||||||||||||||||| ||||||||| |
|
|
| T |
27813470 |
aaattaatcaaaatctgcgactaacaac-aaacaatctaaaaccagagtatgcaatattatcaatgcaaacagaaaggatacctttac |
27813556 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 8 - 75
Target Start/End: Complemental strand, 19245485 - 19245415
Alignment:
| Q |
8 |
atatcaacacgttggtcttcatcaatctctt---gtgaacggactgtttggtgtgaaagaataaaagaaaa |
75 |
Q |
| |
|
||||||||||||| ||||||||||||||||| ||||| |||||| ||||||||||||||||| |||| |
|
|
| T |
19245485 |
atatcaacacgttcgtcttcatcaatctcttacggtgaagagactgtgcggtgtgaaagaataaaaaaaaa |
19245415 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University