View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6189_high_16 (Length: 245)

Name: NF6189_high_16
Description: NF6189
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6189_high_16
NF6189_high_16
[»] chr2 (1 HSPs)
chr2 (22-245)||(37362131-37362354)


Alignment Details
Target: chr2 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 22 - 245
Target Start/End: Original strand, 37362131 - 37362354
Alignment:
22 tttgatttttagggttatatggagggaattaaaagaaaattttgggaaaaatcaatgaagaaagctttgatttttatgtgtgaaataaaattgctgagta 121  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||    
37362131 tttgatttttagggttatatggagggaattaaaagaaaattttgggaaaaatcaatgaagaaaactttgatttttatgtgtgaaattaaattgctgagta 37362230  T
122 gtgttagatagaacttgtactttttgggtggaaaatttatcttaatatacaatgaaatttgataaatcgaaacaaatgttaggccaaaacaatggcactt 221  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||    
37362231 gtgttagatagaacttgtactttttggatggaaaatttatcttaatatataatgaaatttgataaatcgaaacaaatgttaggccaaaacaatggcactt 37362330  T
222 aaaattgactcctaatttgagttt 245  Q
    ||||||||||||||||||||||||    
37362331 aaaattgactcctaatttgagttt 37362354  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University