View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6189_high_3 (Length: 462)
Name: NF6189_high_3
Description: NF6189
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6189_high_3 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 413; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 413; E-Value: 0
Query Start/End: Original strand, 20 - 452
Target Start/End: Complemental strand, 2302865 - 2302433
Alignment:
| Q |
20 |
tgagaatgttgacaaagataaggcatagaaatattttgaaactttatggtttttgcttgcacaatagatgcatgttcttggttttggaatatatggaaaa |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2302865 |
tgagaatgttgacaaagataaggcatagaaatattttgaagctttatggtttttgcttgcacaatagatgcatgttcttggttttggaatatatggaaaa |
2302766 |
T |
 |
| Q |
120 |
gggaagcttgtattgtgttctacacaatgatgttgaagcagtggaattggattggtgtaaaagggttgagattgtgaaaggaattgcaaatagcttatct |
219 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2302765 |
gggaagcttgtattgtgttctacgcaatgatgttgaagcagtggaattggattggtgtaaaagggttgagattgtgaaaggaattgcaaatagcttatct |
2302666 |
T |
 |
| Q |
220 |
taccttcattatgattgcaagccagcaattattcacagagatgttactaccaaaaatgttctcttgaactcagaaatggaagcttgtctttctgattttg |
319 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2302665 |
taccttcattatgattgcgagccagcaattattcacagagatgtgactaccaaaaatgttctcttgaactcagaaatggaagcttgtctttctgattttg |
2302566 |
T |
 |
| Q |
320 |
gcatagctagacttcgaaattctagttcgtcgaaccggacagtacttgcaggcacatatggatatattgcaccaggtgatcttttttatatgttaattgt |
419 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2302565 |
gcatagctagacttcgaaattctagttcgtcgaaccggacagtccttgcaggcacatatggatatattgcaccaggtgatcttttttatatgttaattgt |
2302466 |
T |
 |
| Q |
420 |
tggaaattccttcttaaatgtagtctgcctttg |
452 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
2302465 |
tggaaattccttcttaaatgtagtctgcctttg |
2302433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University