View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6189_low_12 (Length: 275)
Name: NF6189_low_12
Description: NF6189
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6189_low_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 104; Significance: 6e-52; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 1 - 145
Target Start/End: Original strand, 2656158 - 2656300
Alignment:
| Q |
1 |
gggactgagaatcacagtagacttgtcattgagatccaactcttgtcccatcaataattccagagtcctataattatactattagnnnnnnnnnnnngca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
2656158 |
gggactgagaatcacagtagacttgtcattgagatccaactcttgtcccatcaataattccagagtcctataattatactattag--ttttttttttgca |
2656255 |
T |
 |
| Q |
101 |
agggtgagtaaaattgaacagcaacagtttatcattcagcataaa |
145 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2656256 |
agggtgagtaaaattgaacagcaacagtttatcattcagcataaa |
2656300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 192 - 260
Target Start/End: Original strand, 2656458 - 2656526
Alignment:
| Q |
192 |
tatgtaacgcagatannnnnnngtaaagtgatgataattgtatttcaaatgatgagtatagtagtaagt |
260 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2656458 |
tatgtaacgcagatatttttttgtaaagtgatgataattgtatttcaaatgatgagtatagtagtaagt |
2656526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University