View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6189_low_14 (Length: 251)
Name: NF6189_low_14
Description: NF6189
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6189_low_14 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 7 - 241
Target Start/End: Complemental strand, 33116786 - 33116552
Alignment:
| Q |
7 |
atatgatgaagattggtgattacctatcttcttttaaggaaatgttaatttagagtgatgattattggtgaataaactcatcttcaacaatttacaaacc |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33116786 |
atatgatgaagattggtgattacctatcttcttttaaggaaattttaattcagagtgatgattattggtgaataaactcatcttcaacaatttacaaacc |
33116687 |
T |
|
| Q |
107 |
tttagtataccattgaatcccagttccctgaaacattaccacccctttgtattgttttctttcattcatgttataatttattagagaatgataatattct |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33116686 |
tttagtataccattgaatcccagttccctgaaacattaccacctctttgtattgttttccttcattcatgttataatttattagagaatgataatattct |
33116587 |
T |
|
| Q |
207 |
cacggaagtgagttttggtatgtaacattcctttg |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
33116586 |
cacggaagtgagttttggtatgtaacattcctttg |
33116552 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University