View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6189_low_15 (Length: 250)
Name: NF6189_low_15
Description: NF6189
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6189_low_15 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 19 - 250
Target Start/End: Original strand, 812500 - 812730
Alignment:
| Q |
19 |
catacagattcactaaaactgatgtgtaatcttaacagtctaatctcaaattatcgattaaagttaattacaatgtaaagtagtttggaactctacatca |
118 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
812500 |
catacagcttcactaaaattgatgtgtaatcttaacagtctaatctcaaattatcgattaaaattaattacaatgtaaagtagtttggaactctacatca |
812599 |
T |
 |
| Q |
119 |
catcacacatagccctatatatcctgagcactcttgctagtggaatattattatcttagctggtttgtgcatccaagcaagctcttccgttgcaactaaa |
218 |
Q |
| |
|
|| || | | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
812600 |
ca-catagaactatatatatatcctgagcactcttgctagtggaatattattatcttagctggtttgtgcatccaaacaagctcttccgttgcaactaaa |
812698 |
T |
 |
| Q |
219 |
gggctgctacttattaagaagcacaattaatt |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
812699 |
gggctgctacttattaagaagcacaattaatt |
812730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University