View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6189_low_17 (Length: 245)
Name: NF6189_low_17
Description: NF6189
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6189_low_17 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 22 - 245
Target Start/End: Original strand, 37362131 - 37362354
Alignment:
| Q |
22 |
tttgatttttagggttatatggagggaattaaaagaaaattttgggaaaaatcaatgaagaaagctttgatttttatgtgtgaaataaaattgctgagta |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||| |
|
|
| T |
37362131 |
tttgatttttagggttatatggagggaattaaaagaaaattttgggaaaaatcaatgaagaaaactttgatttttatgtgtgaaattaaattgctgagta |
37362230 |
T |
 |
| Q |
122 |
gtgttagatagaacttgtactttttgggtggaaaatttatcttaatatacaatgaaatttgataaatcgaaacaaatgttaggccaaaacaatggcactt |
221 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37362231 |
gtgttagatagaacttgtactttttggatggaaaatttatcttaatatataatgaaatttgataaatcgaaacaaatgttaggccaaaacaatggcactt |
37362330 |
T |
 |
| Q |
222 |
aaaattgactcctaatttgagttt |
245 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
37362331 |
aaaattgactcctaatttgagttt |
37362354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University