View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6191_high_13 (Length: 361)
Name: NF6191_high_13
Description: NF6191
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6191_high_13 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 313; Significance: 1e-176; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 313; E-Value: 1e-176
Query Start/End: Original strand, 15 - 343
Target Start/End: Complemental strand, 48961044 - 48960716
Alignment:
| Q |
15 |
caaaggagagggtggtgaattagtggatctggcatttggcgaatgcattgggctacgaacgttttgtttaatagtttttggagattgagtgggaattgga |
114 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48961044 |
caaaggagatggtggtgaattagtggatctggcatttggcgaatgcattgggctacgaacgttttgtttaatagtttttggagattgagtgggaattgga |
48960945 |
T |
 |
| Q |
115 |
acacgagaagtgttggctgtagttttctctggggaagaactacttgaatattgtgttgtcttttgaataggagaagatggcatcgaagaagatgaagaag |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48960944 |
acacgagaagtgttggctgtagttttctctggggaagaactacttgaatattgtgttgtcttttgaataggagaagatggcatcgaagaagatgaagaag |
48960845 |
T |
 |
| Q |
215 |
aattaggaaacaagcccctatgaggtggagatgaaaatgtttgttctgttttcttttcttgaggttgagtctgattatgaggtgatgggggtgctgaagc |
314 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
48960844 |
aattgggaaacaagcccctatgaggtggagatgaaagtgtttgttctgttttcttttcttgaggttgagtttgattatgaggtgatgggggtgctgaagc |
48960745 |
T |
 |
| Q |
315 |
agtcctaaatgtgggtagagacatagtag |
343 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
48960744 |
agtcctaaatgtgggtagagacatagtag |
48960716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University