View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6191_high_24 (Length: 287)
Name: NF6191_high_24
Description: NF6191
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6191_high_24 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 278
Target Start/End: Original strand, 43059838 - 43060116
Alignment:
| Q |
1 |
gaagatataatttcgttttctcctccaaatgtctcaaaannnnnnnnnnnnnnaacccttgataaatcaagattttagacc-tctgtaatggtggatgtt |
99 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
43059838 |
gaagatgtaatttcgttttctcctccaaatgtctcataatttttaatttttttaacccttgataaatcaagattttagaccctcaataatggtggatgtt |
43059937 |
T |
 |
| Q |
100 |
tcacctatttaacatgcaccatctttcttcacttttcgtagggtccaaatgtctcctttgacatgtgtttgggacaaaattttcacaaattggttgctct |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43059938 |
tcacctatttaacatgcaccatctttcttcacttttcgtagggtccaaatgtctcctttgacatgtgtttgggacaaaattttcacaaattggttgctct |
43060037 |
T |
 |
| Q |
200 |
tcatatcttcaatgtacttgctctcccttgcttccataacttctatacataagatgccttttcctccatcattcctatg |
278 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
43060038 |
tcatatcttcaatgtacttgctctgccttgcttccataacttctatatataagatgccttttcctccatcattcctatg |
43060116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University