View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6191_high_27 (Length: 277)
Name: NF6191_high_27
Description: NF6191
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6191_high_27 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 18 - 267
Target Start/End: Complemental strand, 43321495 - 43321245
Alignment:
| Q |
18 |
ttttccatatcatatgttcgttaaaatagaatacaacaatctgacactcacatactcgtcagactgctaaaaaacacttctagatatatccctttctcgc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
43321495 |
ttttccatatcatatgttcgttaaaatagaatacaacaatctgacactcacatactcgtcagactgctaataaacacttctagatatatccctttctcgc |
43321396 |
T |
 |
| Q |
118 |
aaaggagcggtacaagcattttcagtttcacttc-aaggatactgcgtaatctctctcaagaattggggatggagcagctgaacagctttgaataaaagc |
216 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43321395 |
aaaggagcagtacaagcattttcagtttcacttcaaaggatactgcgtaatctctctcaagaattggggatggagcagctgaacagctttgaataaaagc |
43321296 |
T |
 |
| Q |
217 |
aaagagaagagcaaagttatcaacatatctgtaatctgtttatgaagaatt |
267 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
43321295 |
aaagagaagagcaaagtcatcaacatatctgtaatctgtttatgaagaatt |
43321245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University