View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6191_high_28 (Length: 261)
Name: NF6191_high_28
Description: NF6191
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6191_high_28 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 15 - 244
Target Start/End: Complemental strand, 3711331 - 3711104
Alignment:
| Q |
15 |
catagggtaatggttggacatacccacgtcatcatcagccctagaggtgggg-tgtacctacaaacactcatatattcaagtcagtaagtgtgtaagcga |
113 |
Q |
| |
|
|||| |||| |||||||| ||||||||||||||| ||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
3711331 |
catatggtagtggttggatatacccacgtcatca---gcccttgaggtgggggtgtacctacaaacactcatatattcaagtcagtaagtgtgtaggcga |
3711235 |
T |
 |
| Q |
114 |
gaggnnnnnnnaggttagaaagtgtgttccttggaaaatgttgctagttagtctttagagtgggtggattatggtttaatggaccccaaaatccaatctt |
213 |
Q |
| |
|
|||| |||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3711234 |
gaggtttttttaggttagaaagtgtgtaccttagaaaatgttgctagttagtctttagagtgggtggattatggtttaatggaccccaaaatccaatctt |
3711135 |
T |
 |
| Q |
214 |
gaacaattgtcttttcagatagttgtagata |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
3711134 |
gaacaattgtcttttcagatagttgtagata |
3711104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University